TLR6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag

Price:
Size:
Number:

TLR6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
2391 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Macaca mulatta (Rhesus monkey) toll-like receptor 6.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

TLR6 Background Information

Toll like receptors (TLRs) are involved in the modulation of diverse host genes expression through a complex network of signalling events that allow for an appropriate response to a microbial pathogen. The deregulated TLR6 expression may potentiate TLR2-mediated liver inflammation in NAFLD pathogenesis, and also serve as a potential peripheral biomarker of obesity-related NASH. Current evidence suggests that gut dysbiosis drives obesity and non-alcoholic fatty liver disease (NAFLD) pathogenesis.
Full Name
toll like receptor 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait