pCMV3-C-OFPSpark®

pCMV3-C-OFPSpark® Physical Map
Download sequence
pCMV3-C-OFPSpark® Physical Map

Comments for pCMV3-C-OFPSpark®:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 3047-3416
  • • Hygromycin ORF: bases 3932-3930
  • • pUC origin: bases 5102-5775
  • • Kanamycin ORF: bases 5849-6664

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-C-OFPSpark® Information Description

Vector Name pCMV3-C-OFPSpark®
Vector Size 6806bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag OFPSpark®
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

OFPSpark® Tag Information

OFPSpark® is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark® is more than twice brighter than mOrange2. Fast OFPSpark® maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection.

OFPSpark® can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark® expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark® performs well in some fusions and protein labeling applications.

Mammalian Expression Vectors

More Reagents and Services