pCMV / hygro-Negative Control Vector (His-tagged)

  • Negative control for the pCMV / hygro-His clone.
  • sequence is the same as pCMV / hygro-His, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV / hygro-Negative Control Vector (His-tagged) Physical Map
Vector Sequence
 Vector Name pCMV / hygro-His
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)


Schematic of pCMV / hygro-Negative Control Vector (His-tagged) Multiple Cloning Sites

  • Generation of a monoclonal antibody recognizing the heavily glycosylated CD45 protein and its application on identifying circulating tumor cells
    Zhang, W;Li, Z;Wang, Z;Yue, C;Zheng, H;Li, R;Zhou, M;Hu, Z;Wei, Z;Li, Q;
    PLoS ONE
  • Triptolide interferes with XRCC1/PARP1-mediated DNA repair and confers sensitization of triple-negative breast cancer cells to cisplatin
    Zhang, Z;Sun, C;Zhang, L;Chi, X;Ji, J;Gao, X;Wang, Y;Zhao, Z;Liu, L;Cao, X;Yang, Y;Mao, W;
    Biomedicine & Pharmacotherapy
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait