NCP-CoV(2019-nCoV) Spike(RBD) ORF mammalian expression plasmid (Codon Optimized)

1/1
Price:
Size:
Number:

NCP-CoV(2019-nCoV) Spike(RBD) ORF mammalian expression plasmid (Codon Optimized): General Information

Gene
Species
2019-nCoV
RefSeq ORF Size
675 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system.The translated amino acid sequence is identical with QHD43416.1(319-541aa)
Description
Full length Clone DNA of 2019-nCoV Spike(RBD).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+0.68kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV spike cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NCP-CoV(2019-nCoV) Spike(RBD) ORF mammalian expression plasmid (Codon Optimized): Validated Images

NCP-CoV(2019-nCoV) Spike(RBD) ORF mammalian expression plasmid (Codon Optimized): Alternative Names

coronavirus spike cDNA ORF Clone, 2019-nCoV; cov spike cDNA ORF Clone, 2019-nCoV; ncov RBD cDNA ORF Clone, 2019-nCoV; ncov s1 cDNA ORF Clone, 2019-nCoV; ncov s2 cDNA ORF Clone, 2019-nCoV; ncov spike cDNA ORF Clone, 2019-nCoV; NCP-CoV RBD cDNA ORF Clone, 2019-nCoV; NCP-CoV s1 cDNA ORF Clone, 2019-nCoV; NCP-CoV s2 cDNA ORF Clone, 2019-nCoV; NCP-CoV Spike cDNA ORF Clone, 2019-nCoV; novel coronavirus RBD cDNA ORF Clone, 2019-nCoV; novel coronavirus s1 cDNA ORF Clone, 2019-nCoV; novel coronavirus s2 cDNA ORF Clone, 2019-nCoV; novel coronavirus spike cDNA ORF Clone, 2019-nCoV; RBD cDNA ORF Clone, 2019-nCoV; S1 cDNA ORF Clone, 2019-nCoV; S2 cDNA ORF Clone, 2019-nCoV; Spike RBD cDNA ORF Clone, 2019-nCoV

CoV spike Background Information

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell. Known receptors bind S1 are ACE2, angiotensin-converting enzyme 2; DPP4, dipeptidyl peptidase-4; APN, aminopeptidase N; CEACAM, carcinoembryonic antigen-related cell adhesion molecule 1; Sia, sialic acid; O-ac Sia, O-acetylated sialic acid. The spike is essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. It's been reported that 2019-nCoV can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two subunits, S1 and S2. S1 mainly contains a receptor binding domain (RBD), which is responsible for recognizing the cell surface receptor. S2 contains basic elements needed for the membrane fusion.The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity. The main functions for the Spike protein are summarized as: Mediate receptor binding and membrane fusion; Defines the range of the hosts and specificity of the virus; Main component to bind with the neutralizing antibody; Key target for vaccine design; Can be transmitted between different hosts through gene recombination or mutation of the receptor binding domain (RBD), leading to a higher mortality rate.
References
  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.

CoV spike cDNA ORF Clone, 2019-nCoV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait