Human cytomegalovirus (HCMV) gB ORF mammalian expression plasmid, N-HA tag

1/1
Price:
Size:
Number:

Human cytomegalovirus (HCMV) gB ORF mammalian expression plasmid, N-HA tag: General Information

Gene
Species
CMV
NCBI Ref Seq
RefSeq ORF Size
2724 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo cytomegalovirus gB with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb+2.75kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CMV Glycoprotein B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Human cytomegalovirus (HCMV) gB ORF mammalian expression plasmid, N-HA tag: Validated Images

CMV Glycoprotein B Background Information

Cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which belongs to the herpesviridae glycoprotein B family. It is a 97-amino acid glycoprotein encoded by the ORF of UL55. Cytomegalovirus Glycoprotein B protein is the most abundant component of the envelope, a target of neutralizing antibodies with at least two defined neutralizing epitopes and an essential replication component. Cytomegalovirus Glycoprotein B protein plays important roles in HCMV entry, cell-cell spread of internal virions, and fusion of infected cells. In addition, Cytomegalovirus Glycoprotein B protein is one envelope protein capable of heparin binding. It forms a physical association with host cell annexin II independent of the presence of calcium.
References
  • Lopper M,et al. (2002). Disulfide bond configuration of human cytomegalovirus glycoprotein B. J Virol. 76(12): 6073-82.
  • Isaacson MK, et al. (2009) Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J Virol. 83(8): 3891-903.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait