ABI2 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

ABI2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Human abl-interactor 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABI2 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ABI-2 cDNA ORF Clone, Human; ABI2B cDNA ORF Clone, Human; AblBP3 cDNA ORF Clone, Human; AIP-1 cDNA ORF Clone, Human; argBP1 cDNA ORF Clone, Human; argBPIA cDNA ORF Clone, Human; argBPIB cDNA ORF Clone, Human; SSH3BP2 cDNA ORF Clone, Human

ABI2 Background Information

Abl-interactor 2 (Abi2) is known as a tumor suppressor and a cell migration inhibitor. Abelson (Abl) interactor 2 (Abi-2) has been considered as a key regulator of cell/tissue structural organization and is differentially expressed in leiomyomas,which had been proved a key regulatory function in leiomyomas cellular/tissue structural organization during growth and regression.
Full Name
abl-interactor 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait