Zika virus (ZIKV)(ZikaSPH2015) prM protein and Envelope / Zika-prM and E natural Gene ORF cDNA clone expression plasmid

1/1
Price:
Size:
Number:

Zika virus (ZIKV)(ZikaSPH2015) prM protein and Envelope / Zika-prM and E natural Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
ZIKV
NCBI Ref Seq
RefSeq ORF Size
2019 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Zika virus(ZIKV)(ZikaSPH2015) prM and E.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI(6.1kb+2.00kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ZIKV prM protein and Envelope cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Zika virus (ZIKV)(ZikaSPH2015) prM protein and Envelope / Zika-prM and E natural Gene ORF cDNA clone expression plasmid: Validated Images

ZIKV prM protein and Envelope Background Information

The function of Zika virus prM and M is assisting the folding and secretion of E protein. Antibodies toward prM can enhances infectivity of immature virions. E protein of Zika virus plays an important role in receptor binding and membrane fusion.
References
  • Pinto Júnior VL, et al. Zika virus: a review to clinicians, Acta Med Port 2015 Nov-Dec;28(6):760-765
  • Wong SS-Y, et al., Zika virus infectiondthe next wave after dengue?, Journal of the Formosan Medical Association (2016)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.