Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized)

1/1
Price:
Size:
Number:

Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized): General Information

Gene
Species
SARS
RefSeq ORF Size
3768 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP13567.1.
Description
Full length Clone DNA of Human SARS coronavirus (SARS-CoV) Spike glycoprotein DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 3.77kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Coronavirus spike cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized): Validated Images

Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized): Synonyms

coronavirus s1 cDNA ORF Clone, SARS; coronavirus s2 cDNA ORF Clone, SARS; coronavirus spike cDNA ORF Clone, SARS; cov spike cDNA ORF Clone, SARS; ncov RBD cDNA ORF Clone, SARS; ncov s1 cDNA ORF Clone, SARS; ncov s2 cDNA ORF Clone, SARS; ncov spike cDNA ORF Clone, SARS; novel coronavirus RBD cDNA ORF Clone, SARS; novel coronavirus s1 cDNA ORF Clone, SARS; novel coronavirus s2 cDNA ORF Clone, SARS; novel coronavirus spike cDNA ORF Clone, SARS; RBD cDNA ORF Clone, SARS; S1 cDNA ORF Clone, SARS; s2 cDNA ORF Clone, SARS; Spike RBD cDNA ORF Clone, SARS

Coronavirus spike Background Information

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell. Known receptors bind S1 are ACE2, angiotensin-converting enzyme 2; DPP4, dipeptidyl peptidase-4; APN, aminopeptidase N; CEACAM, carcinoembryonic antigen-related cell adhesion molecule 1; Sia, sialic acid; O-ac Sia, O-acetylated sialic acid. The spike is essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. It's been reported that SARS-CoV-2 (COVID-19 coronavirus, 2019-nCoV) can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two subunits, S1 and S2. S1 mainly contains a receptor binding domain (RBD), which is responsible for recognizing the cell surface receptor. S2 contains basic elements needed for the membrane fusion.The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity. The main functions for the Spike protein are summarized as: Mediate receptor binding and membrane fusion; Defines the range of the hosts and specificity of the virus; Main component to bind with the neutralizing antibody; Key target for vaccine design; Can be transmitted between different hosts through gene recombination or mutation of the receptor binding domain (RBD), leading to a higher mortality rate.
References
  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.

Coronavirus spike cDNA ORF Clone, 2019-nCoV, Related Products

  • Key residues of the receptor binding motif in the spike protein of SARS-CoV-2 that interact with ACE2 and neutralizing antibodies
    Author
    Yi, C;Sun, X;Ye, J;Ding, L;Liu, M;Yang, Z;Lu, X;Zhang, Y;Ma, L;Gu, W;Qu, A;Xu, J;Shi, Z;Ling, Z;Sun, B;
    Year
    2020
    Journal
    Cell. Mol. Immunol.
    Application
    template
  • SARS-CoV-2 and SARS-CoV Spike-RBD Structure and Receptor Binding Comparison and Potential Implications on Neutralizing Antibody and Vaccine Development
    Author
    Xie, L;Sun, C;Luo, C;Zhang, Y;Zhang, J;Yang, J;Chen, L;
    Year
    2020
    Journal
    bioRxiv
  • Bcr-Abl tyrosine kinase inhibitor imatinib as a potential drug for COVID-19
    Author
    Mulgaonkar, N;Wang, H;Mallawarachchi, S;Ruzek, D;Martina, B;Fernando, S;
    Year
    2020
    Journal
    bioRxiv
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.