IL-18 cDNA ORF Clone, Rhesus, N-His tag

Price:
Size:
Number:

IL-18 cDNA ORF Clone, Rhesus, N-His tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Rhesus interleukin 18 (interferon-gamma-inducing factor) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-18 Background Information

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1-like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cell -, IL-4- and STAT6-dependent fashion. IL-18 and T cell receptor-mediated stimulation could induce naive CD4+ T cells to develop into IL-4-producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in the regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feedback to promote Th1 cell development in the synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.
Full Name
interleukin 18
Research Areas
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
References
  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.