EDA2R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag

Price:
Size:
Number:

EDA2R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
894 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Macaca mulatta (Rhesus monkey) ectodysplasin A2 receptor.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

EDA2R Background Information

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type III membrane protein. TNFRSF27 / EDA2R contains threeTNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).
Full Name
ectodysplasin A2 receptor
References
  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait