PD-L2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

PD-L2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
807 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus programmedcelldeath1ligand2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

PD-L2 Background Information

Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.
Full Name
programmed cell death 1 ligand 2
References
  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.