LAG3 cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

LAG3 cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Description
Full length Clone DNA of Rat lymphocyte-activation gene 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LAG3 Background Information

LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.
Full Name
lymphocyte-activation gene 3
Research Areas
References
  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.