IL18BP cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

IL18BP cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Rat interleukin 18 binding protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About IL18BP

Entrez Gene ID

IL18BP Background Information

Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18) and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.
Full Name
interleukin 18 binding protein
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
References
  • Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.
  • Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.
  • Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.