EDA2R cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

EDA2R cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rat ectodysplasin A2 receptor with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EDA2R Background Information

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type III membrane protein. TNFRSF27 / EDA2R contains threeTNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).
Full Name
ectodysplasin A2 receptor
References
  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait