Cyclophilin B cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Cyclophilin B cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat peptidylprolyl isomerase B with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cyclophilin B Background Information

PPIB is identified as a candidate gene for OI-IX. Osteogenesis imperfecta (OI) is an inherited disorder of connective tissue typically caused by defects in either COL1A1 or COL1A2. A number of other genes causative of this disorder have been found, including PPIB, which forms one subunit of the prolyl 3-hydroxylase enzyme complex. Patients with OI caused by PPIB mutation should have appropriate early and regular management of their hearing.
Full Name
peptidylprolyl isomerase B (cyclophilin B)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.