CD300A cDNA ORF Clone, Rat, N-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

CD300A cDNA ORF Clone, Rat, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Rat CD300A molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CD300A Background Information

CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ). CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes. It contains oneIg-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor that may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).
Full Name
CD300a molecule
References
  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.