TrkB cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

TrkB cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2466 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1593T/C, 2178 C/T, 2328 G/C and 2358 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse neurotrophic tyrosine kinase, receptor, type 2, transcript variant 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 2.47kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TrkB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TrkB cDNA ORF Clone, Mouse, untagged: Validated Images

TrkB cDNA ORF Clone, Mouse, untagged: Synonyms

GP145-TrkB/GP95-TrkB cDNA ORF Clone, Mouse; Tkrb cDNA ORF Clone, Mouse; trk-B cDNA ORF Clone, Mouse; trkB cDNA ORF Clone, Mouse

TrkB Background Information

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptor with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K, and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB, and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has the highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, long-term potentiation, and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signaling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.
Full Name
neurotrophic tyrosine kinase, receptor, type 2
References
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.