SERPINB10 cDNA ORF Clone, Mouse, N-OFPSpark® tag

Price:
Size:
Number:

SERPINB10 cDNA ORF Clone, Mouse, N-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SERPINB10 cDNA ORF Clone, Mouse, N-OFPSpark® tag: Synonyms

9830131G07 cDNA ORF Clone, Mouse; BB233602 cDNA ORF Clone, Mouse; Serpin B10 cDNA ORF Clone, Mouse; Serpinb10-ps cDNA ORF Clone, Mouse

SERPINB10 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1 serpins have been identified.
Mouse SerpinB1, also known as Peptidase inhibitor 1, PI-1, Bomapin and SERPINB1, is a nucleus and cytoplasm protein that belongs to the serpin family and Ov-serpin subfamily. SerpinB1 is expressed specifically in the bone marrow. SerpinB1 is a protease inhibitor that may play a role in the regulation of protease activities during hematopoiesis and apoptosis induced by TNF. SerpinB1 is a redox-sensitive nuclear serpin that augments proliferation or apoptosis of leukaemia cells, depending on growth factors availability. SerpinB1 may regulate protease activities in the cytoplasm and the nucleus.
Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 10
References
  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.