S6K1/RPS6KB1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

S6K1/RPS6KB1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Description
Full length Clone DNA of Mouse ribosomal protein S6 kinase, polypeptide 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

More Information About S6K1/RPS6KB1

Entrez Gene ID

S6K1/RPS6KB1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Synonyms

2610318I15Rik cDNA ORF Clone, Mouse; 4732464A07Rik cDNA ORF Clone, Mouse; 70kDa cDNA ORF Clone, Mouse; AA959758 cDNA ORF Clone, Mouse; AI256796 cDNA ORF Clone, Mouse; AI314060 cDNA ORF Clone, Mouse; p70/85s6k cDNA ORF Clone, Mouse; p70s6k cDNA ORF Clone, Mouse; S6K1 cDNA ORF Clone, Mouse

S6K1/RPS6KB1 Background Information

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.
Full Name
ribosomal protein S6 kinase, polypeptide 1
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
References
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.