MMP-9 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

MMP-9 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2193 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 834G/A and 1962C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse matrix metallopeptidase 9 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 2.23kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MMP-9 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-9 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

MMP-9 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Synonyms

AW743869 cDNA ORF Clone, Mouse; B/MMP9 cDNA ORF Clone, Mouse; Clg4b cDNA ORF Clone, Mouse; MMP-9 cDNA ORF Clone, Mouse; pro-MMP-9 cDNA ORF Clone, Mouse

MMP-9 Background Information

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis, and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases, and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and some transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodeling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent on the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. Besides, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.
Full Name
matrix metallopeptidase 9
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Gelatinases Cleave Dentin Sialoprotein Intracellularly
    Author
    Gou, X;Xue, Y;Zheng, H;Yang, G;Chen, S;Chen, Z;Yuan, G;
    Year
    2020
    Journal
    Front. Physiol.
    Application
    cell culture
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.