MAPK11 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

MAPK11 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 11 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAPK11 cDNA ORF Clone, Mouse, N-HA tag: Synonyms

p38-2 cDNA ORF Clone, Mouse; P38b cDNA ORF Clone, Mouse; p38beta cDNA ORF Clone, Mouse; p38beta2 cDNA ORF Clone, Mouse; Prkm11 cDNA ORF Clone, Mouse; Sapk2 cDNA ORF Clone, Mouse; Sapk2b cDNA ORF Clone, Mouse

MAPK11 Background Information

The p38 kinases are one of the four subgroups of the mitogen-activated protein kinase (MAPK) superfamily which are involved in innate immunity. The p38 subfamily includes four members namely p38alpha (MAPK14), p38beta (MAPK11), p38gamma (MAPK12), and p38delta (MAPK13), regulates the activation of several transcription factors. MAPK11 (Mitogen-Activated Protein Kinase 11) is a Protein Coding gene. This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. MAPK11 is widely expressed in fat, the brain, and other tissues. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen-activated protein kinase kinases (MKKs).
Full Name
mitogen-activated protein kinase 11
Related Pathways
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.