Leptin cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

Leptin cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Mouse leptin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.55kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Leptin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Leptin cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Leptin cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag: Synonyms

ob cDNA ORF Clone, Mouse; obese cDNA ORF Clone, Mouse

Leptin Background Information

Leptin is one of the most important hormones secreted by adipocytes, as an adipokine that modulates multiple functions including energy homeostasis, thermoregulation, bone metabolism, endocrine, and pro-inflammatory immune responses. The circulating leptin levels serve as a gauge of energy stores, thereby directing the regulation of energy homeostasis, neuroendocrine function, and metabolism. Recent studies suggest that leptin is physiologically more important as an indicator of energy deficiency, rather than energy excess, and may mediate adaptation by driving increased food intake and directing neuroendocrine function to converse energy, such as inducing hypothalamic hypogonadism to prevent fertilization. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone Leptin has been shown to regulate the immune response, innate, and adaptive response, both in normal and pathological conditions. Thus, Leptin is a mediator of the inflammatory response. Leptin has a dual effect on bone, acting by two independent mechanisms. As a signal molecule with growth factor characteristics, leptin can stimulate osteoblastic cells and inhibit osteoclast formation and activity, thus promoting osteogenesis. However, as a molecule that stimulates sympathetic neurons in the hypothalamus, leptin indirectly inhibits bone formation. This inhibitory effect of leptin mediated by activation of the sympathetic nervous system can be abrogated by the application of blood pressure-reducing beta-blockers, which also inhibit receptors of hypothalamic adrenergic neurons. Leptin appears to regulate some features defining Alzheimer's disease (AD) at the molecular and physiological level. Leptin can stimulate mitogenic and angiogenic processes in peripheral organs. Because leptin levels are elevated in obese individuals and excess body weight has been shown to increase breast cancer risk in postmenopausal women. Furthermore, a recent report clearly shows that targeting leptin signaling may reduce mammary carcinogenesis.
Full Name
leptin
Related Pathways
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
References
  • Surmacz E. (2007) Obesity hormone leptin: a new target in breast cancer? Breast Cancer Res. 9(1): 301.
  • Wodarski K, et al. (2009) Leptin as a modulator of osteogenesis. Ortop Traumatol Rehabil. 11(1): 1-6.
  • Tezapsidis N, et al. (2009) Leptin: a novel therapeutic strategy for Alzheimer's disease. J Alzheimers Dis. 16(4): 731-40.
  • Cai C, et al. (2009) Leptin in non-autoimmune inflammation. Inflamm Allergy Drug Targets. 8(4): 285-91.
  • Fernndez-Riejos P, et al. (2010) Role of leptin in the activation of immune cells. Mediators Inflamm. 2010: 568343.
  • Kelesidis T, et al. (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Ann Intern Med. 152(2): 93-100.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.