LAG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

LAG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus lymphocyte-activation gene 3
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Citation List

LAG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

CD223 cDNA ORF Clone, Mouse; LAG-3 cDNA ORF Clone, Mouse; Ly66 cDNA ORF Clone, Mouse

LAG3 Background Information

LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.
Full Name
lymphocyte-activation gene 3
Research Areas
References
  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.