IL28A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

IL28A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus interferon lambda 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

More Information About IL28A

Entrez Gene ID

IL28A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

EG330496 cDNA ORF Clone, Mouse; Ifnl2 cDNA ORF Clone, Mouse; IL-28A cDNA ORF Clone, Mouse; IL28A cDNA ORF Clone, Mouse

IL28A Background Information

Full Name
interferon, lambda 2
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • Autophagy Pathway
    Autophagy Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.