IFN-alpha 13 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

IFN-alpha 13 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Mouse interferon alpha 13.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IFN-alpha 13 cDNA ORF Clone, Mouse, untagged: Synonyms

RP23-139P14.1 cDNA ORF Clone, Mouse

IFN-alpha 13 Background Information

Full Name
interferon, alpha 13
References
  • Mahmutovic S, et al.. (2004) Significance of the interferon (IFN) in the therapy. Bosn J Basic Med Sci. 4(4): 42-4.
  • Wang, et al.. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.

IFN-alpha 13 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.