IFN-alpha 13 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

IFN-alpha 13 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Mouse interferon alpha 13 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IFN-alpha 13 cDNA ORF Clone, Mouse, N-HA tag: Synonyms

RP23-139P14.1 cDNA ORF Clone, Mouse

IFN-alpha 13 Background Information

Full Name
interferon, alpha 13
References
  • Mahmutovic S, et al.. (2004) Significance of the interferon (IFN) in the therapy. Bosn J Basic Med Sci. 4(4): 42-4.
  • Wang, et al.. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.

IFN-alpha 13 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.