GABARAPL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

GABARAPL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GABARAPL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

3110025G09Rik cDNA ORF Clone, Mouse; 9130422N19Rik cDNA ORF Clone, Mouse; AI196471 cDNA ORF Clone, Mouse; Apg8l cDNA ORF Clone, Mouse; Atg8l cDNA ORF Clone, Mouse; GECI cDNA ORF Clone, Mouse; MNCb-0091 cDNA ORF Clone, Mouse

GABARAPL1 Background Information

ATG8, also known as GABARAPL1, is a ubiquitin-like protein that has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.
Full Name
GABA(A) receptor-associated protein like 1
References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.