FZD1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

FZD1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1929 bp
Description
Full length Clone DNA of Mouse frizzled homolog 1 (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FZD1 cDNA ORF Clone, Mouse, N-Myc tag: Synonyms

AW227548 cDNA ORF Clone, Mouse; FZ-1 cDNA ORF Clone, Mouse; Fz1 cDNA ORF Clone, Mouse

FZD1 Background Information

Frizzled-1, also known as FZD1, belongs to theG-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.
Full Name
frizzled class receptor 1
Related Pathways
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
  • Autophagy Pathway
    Autophagy Pathway
References
  • Gazit A., et al.,(1999), Human frizzled 1 interacts with transforming Wnts to transduce a TCF dependent transcriptional response. Oncogene 18:5959-5966.
  • Sagara N., et al., (1998), Molecular cloning, differential expression, and chromosomal localization of human frizzled-1, frizzled-2, and frizzled-7.Biochem. Biophys. Res. Commun. 252:117-122.
  • Scherer S.W., et al.,(2003), Human chromosome 7: DNA sequence and biology.Science 300:767-772.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.