FCGR4 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

FCGR4 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Mouse Fc receptor, IgG, low affinity IV with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FCGR4 cDNA ORF Clone, Mouse, C-Myc tag: Synonyms

4833442P21Rik cDNA ORF Clone, Mouse; CD16-2 cDNA ORF Clone, Mouse; FcgammaRIV cDNA ORF Clone, Mouse; Fcgr3a cDNA ORF Clone, Mouse; FcgRIV cDNA ORF Clone, Mouse; Fcrl3 cDNA ORF Clone, Mouse

FCGR4 Background Information

Full Name
Fc receptor, IgG, low affinity IV
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.