Fas Ligand cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

Fas Ligand cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Mouse Fas ligand (TNF superfamily, member 6) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Citation List

Fas Ligand cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Synonyms

Apt1lg1 cDNA ORF Clone, Mouse; CD178 cDNA ORF Clone, Mouse; CD95-L cDNA ORF Clone, Mouse; Cd95l cDNA ORF Clone, Mouse; Fas-L cDNA ORF Clone, Mouse; Fasl cDNA ORF Clone, Mouse; Faslg cDNA ORF Clone, Mouse; gld cDNA ORF Clone, Mouse; Tnfsf6 cDNA ORF Clone, Mouse

Fas Ligand Background Information

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.
Full Name
Fas ligand
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • p53 Pathway
    p53 Pathway
References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.

Fas Ligand cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.