DNase I cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

DNase I cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
900 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse deoxyribonuclease I with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.9kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DNase I cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNase I cDNA ORF Clone, Mouse, C-His tag: Validated Images

DNase I cDNA ORF Clone, Mouse, C-His tag: Synonyms

AI788650 cDNA ORF Clone, Mouse; DNaseI cDNA ORF Clone, Mouse; Dnl1 cDNA ORF Clone, Mouse

DNase I Background Information

DNase1, also known as deoxyribonuclease I and DNL1, is a member of the DNase family. DNaseI is a nuclease that cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5'-phosphate-terminated polynucleotides with a free hydroxyl group on position 3', on average producing tetranucleotides. DNaseI binds to the cytoskeletal protein actin. It binds actin monomers with very high (sub-nanomolar) affinity and actin polymers with lower affinity. Mutations in DNase1 gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. DNase1 is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity.
Full Name
deoxyribonuclease I
References
  • Shak S. et al., 1991, Proc Natl Acad Sci. 87 (23): 9188-92.
  • Yasutomo K. et al., 2001, Nat Genet. 28 (4): 313-4.
  • Hakkim A. et al., 2010, Proc Natl Acad Sci. 107 (21): 9813-8.

DNase I cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.