CD52 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

CD52 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
225 bp
Description
Full length Clone DNA of Mouse CD52 antigen with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Citation List

CD52 cDNA ORF Clone, Mouse, C-Myc tag: Synonyms

AI463198 cDNA ORF Clone, Mouse; B7 cDNA ORF Clone, Mouse; B7-Ag cDNA ORF Clone, Mouse; CAMPATH-1 cDNA ORF Clone, Mouse; CLS1 cDNA ORF Clone, Mouse; MB7 cDNA ORF Clone, Mouse

CD52 Background Information

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.
Full Name
CD52 molecule
Research Areas
References
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.