CD300A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CD300A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
957 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus CD300A antigen.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD300A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

B230315M08Rik cDNA ORF Clone, Mouse; Clm8 cDNA ORF Clone, Mouse; LMIR1 cDNA ORF Clone, Mouse; MAIR-I cDNA ORF Clone, Mouse; MAIR-Ia cDNA ORF Clone, Mouse; mcpir1 cDNA ORF Clone, Mouse; MMAC8 cDNA ORF Clone, Mouse; Pigr4 cDNA ORF Clone, Mouse

CD300A Background Information

CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ). CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes. It contains oneIg-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor that may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).
Full Name
CD300a molecule
References
  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.