Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Mouse calmodulin 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Synonyms

AI256814 cDNA ORF Clone, Mouse; AI327027 cDNA ORF Clone, Mouse; AI461935 cDNA ORF Clone, Mouse; AL024000 cDNA ORF Clone, Mouse; Calm cDNA ORF Clone, Mouse; CaM cDNA ORF Clone, Mouse

Calmodulin 1/CALM1 Background Information

Full Name
calmodulin 1 (phosphorylase kinase, delta)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.