C1QL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

C1QL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent-like 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C1QL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Synonyms

C1qrf cDNA ORF Clone, Mouse; CRF cDNA ORF Clone, Mouse; CTRP14 cDNA ORF Clone, Mouse; gliacolin cDNA ORF Clone, Mouse

C1QL1 Background Information

Full Name
complement component 1, q subcomponent-like 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.