BAFF/BLyS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

BAFF/BLyS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 13b.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

BAFF/BLyS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

BAFF cDNA ORF Clone, Mouse; BLyS cDNA ORF Clone, Mouse; D8Ertd387e cDNA ORF Clone, Mouse; TALL-1 cDNA ORF Clone, Mouse; TALL1 cDNA ORF Clone, Mouse; THANK cDNA ORF Clone, Mouse; TNFSF20 cDNA ORF Clone, Mouse; zTNF4 cDNA ORF Clone, Mouse

BAFF/BLyS Background Information

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors are a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS is an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.
Full Name
tumor necrosis factor (ligand) superfamily, member 13b
References
  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.

BAFF/BLyS cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.