GFPSpark Lentivirus Control Plasmid

Price:
Size:
Number:
GFPSpark® Lentivirus Control Plasmid Physical Map
 
  Vector Sequence
Download     
 
Description
 
Vector Name pLV-GFPSpark®
Vector Size 7281bp
Vector Type Lentiviral Vector
Promoter CMV
Antibiotic Resistance Ampicillin
Protein Tag GFPSpark®
Sequencing Primer pLen-F: 5' CTCGTTTAGTGAACCGTCAGAATT 3'
pLen-R: 5' GAACCGGAACCCTTAAACATGT 3'
 
Cloning Sites for GFPSpark® Inserting
 

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.