Sphingosine Kinase 1 cDNA ORF Clone, Human, N-His tag

1/1
Price:
Size:
Number:

Sphingosine Kinase 1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1008T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human sphingosine kinase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.2kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Sphingosine Kinase 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Sphingosine Kinase 1 cDNA ORF Clone, Human, N-His tag: Validated Images

Sphingosine Kinase 1 cDNA ORF Clone, Human, N-His tag: Synonyms

SPHK cDNA ORF Clone, Human; SPHK1 cDNA ORF Clone, Human; SPK cDNA ORF Clone, Human

Sphingosine Kinase 1 Background Information

SPHK1, also known as sphingosine Kinase 1, catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P). S1P exhibits a broad spectrum of biological activities including cell proliferation, survival, migration, cytoskeletal organization, and morphogenesis. It is a ligand for cell surface G protein-coupled receptors. SPHK 1 is a potential therapeutic target for the control of cancer and inflammation. SPHK1 plays a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes.
Full Name
sphingosine kinase 1
References
  • Kohama T. et al., 1998, J Biol Chem. 273 (37): 23722-8.
  • Xia P. et al., 2002, J Biol Chem. 277 (10): 7996-8003.
  • Tsukahara T. et al., 2002, Tanpakushitsu Kakusan Koso. 47 (4): 509-13.
  • N-AS-triggered SPMs are direct regulators of microglia in a model of Alzheimer's disease
    Author
    Lee, JY;Han, SH;Park, MH;Song, IS;Choi, MK;Yu, E;Park, CM;Kim, HJ;Kim, SH;Schuchman, EH;Jin, HK;Bae, JS;
    Year
    2020
    Journal
    Nat Commun
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.