SLC16A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

SLC16A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2232 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens solute carrier family 16 (monocarboxylate transporter), member 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+2.23kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

SLC16A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC16A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

SLC16A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

HHF7 cDNA ORF Clone, Human; MCT cDNA ORF Clone, Human; MCT1 cDNA ORF Clone, Human; MCT1D cDNA ORF Clone, Human

SLC16A1 Background Information

Full Name
solute carrier family 16 (monocarboxylate transporter), member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.