S6K1/RPS6KB1 cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

S6K1/RPS6KB1 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 2.31kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S6K1/RPS6KB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S6K1/RPS6KB1 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

S6K1/RPS6KB1 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

p70 S6KA cDNA ORF Clone, Human; p70(S6K)-alpha cDNA ORF Clone, Human; p70-alpha cDNA ORF Clone, Human; p70-S6K cDNA ORF Clone, Human; PS6K cDNA ORF Clone, Human; RPS6KB1 cDNA ORF Clone, Human; S6K cDNA ORF Clone, Human; S6K-beta-1 cDNA ORF Clone, Human; S6K1 cDNA ORF Clone, Human; STK14A cDNA ORF Clone, Human

S6K1/RPS6KB1 Background Information

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.
Full Name
ribosomal protein S6 kinase, polypeptide 1
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
References
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.