PLA2G4A cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

PLA2G4A cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2292 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phospholipase A2, group IVA (cytosolic, calcium-dependent) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+2.29kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PLA2G4A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLA2G4A cDNA ORF Clone, Human, N-HA tag: Validated Images

PLA2G4A cDNA ORF Clone, Human, N-HA tag: Synonyms

cPLA2-alpha cDNA ORF Clone, Human; PLA2G4 cDNA ORF Clone, Human

PLA2G4A Background Information

Full Name
phospholipase A2, group IVA (cytosolic, calcium-dependent)
Related Pathways
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
  • Metabolic Fingerprinting Links Oncogenic PIK3CA with Enhanced Arachidonic Acid-Derived Eicosanoids
    Author
    Koundouros, N;Karali, E;Tripp, A;Valle, A;Inglese, P;Perry, NJS;Magee, DJ;Anjomani Virmouni, S;Elder, GA;Tyson, AL;Dória, ML;van Weverwijk, A;Soares, RF;Isacke, CM;Nicholson, JK;Glen, RC;Takats, Z;Poulogiannis, G;
    Year
    2020
    Journal
    Cell
    Application
    QPCR
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.