PIAS3 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PIAS3 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1887 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein inhibitor of activated STAT, 3.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.89kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PIAS3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIAS3 cDNA ORF Clone, Human, untagged: Synonyms

ZMIZ5 cDNA ORF Clone, Human

PIAS3 Background Information

Protein inhibitor of activated STAT3 (PIAS3) is a member of the protein inhibitor of activated STAT (PIAS) family. PIAS3 is an endogenous suppressor of signal transducer and activator of transcription 3 (STAT3) signaling and cell growth and demonstrates limited expression in the majority of human squamous cell carcinomas of the lung. By directly interacting with phosphorylated STAT3, PIAS3 can block the downstream transcriptional activity of STAT3, which is hyper-activated in various cancers. PIAS3 is the only member of the PIAS family that is indispensable for ATR activation. In response to different types of DNA damage and replication stress, PIAS3 plays multiple roles in ATR activation. STAT3 is implicated in guiding the specification of rod and cone photoreceptors through post-translational modification of key retinal transcription factors.
Full Name
protein inhibitor of activated STAT, 3
Related Pathways
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
References
  • Wu CS, et al. (2016) The sumo (small ubiquitin-like modifier) ligase pias3 primes atr for checkpoint activation. J Biol Chem 291 (1): 279-290.
  • He T, et al. (2018) Post-transcriptional regulation of pias3 expression by mir-18a in malignant mesothelioma. Mol Oncol 12 (12): 2124-2135.
  • Dabir S, et al. (2014) Pias3 activates the intrinsic apoptotic pathway in non-small cell lung cancer cells independent of p53 status. Int J Cancer 134 (5): 1045-1054.
  • Campla CK, et al. (2017) Pias3 is necessary for dorso-ventral patterning and visual response of retinal cones but is not required for rod photoreceptor differentiation. Biol Open 6 (6): 881-890.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.