p53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

p53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1911 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens tumor protein p53 (TP53), transcript variant 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+1.91kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

p53 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

p53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

BCC7 cDNA ORF Clone, Human; LFS1 cDNA ORF Clone, Human; P53 cDNA ORF Clone, Human; TRP53 cDNA ORF Clone, Human

p53 Background Information

p53, also known as Tp53, is a DNA-binding protein which belongs to the p53 family. It contains transcription activation, DNA-binding, and oligomerization domains. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 (TP53) is a transcription factor whose protein levels and post-translational modification state alter in response to cellular stress (such as DNA damage, hypoxia, spindle damage). Activation of p53 begins through a number of mechanisms including phosphorylation by ATM, ATR, Chk1 and MAPKs. MDM2 is a ubiquitn ligase that binds p53 and targets p53 for proteasomal degradation. Phosphorylation, p14ARF and USP7 prevent MDM2-p53 interactions, leading to an increase in stable p53 tetramers in the cytoplasm. Further modifications such as methylation and acetylation lead to an increase in Tp53 binding to gene specific response elements. Tp53 regulates a large number of genes (>1 genes) that control a number of key tumor suppressing functions such as cell cycle arrest, DNA repair, senescence and apoptosis. Whilst the activation of p53 often leads to apoptosis, p53 inactivation facilitates tumor progression. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mutants of p53 that frequently occur in a number of different human cancers fail to bind the consensus DNA binding site, and hence cause the loss of tumor suppressor activity. Defects in TP53 are a cause of esophageal cancer, Li-Fraumeni syndrome, lung cancer and adrenocortical carcinoma.
Full Name
tumor protein p53
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • p53 Pathway
    p53 Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
  • Autophagy Pathway
    Autophagy Pathway
References
  • Bakhrat A, et al. (2010) Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis. Apoptosis. 15(12):1425-34.
  • Kurzhals RL, et al. (2011) Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet. 7(6):e1002103.
  • Pardi N, et al. (2011) In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62(4):397-412.
  • Wells BS, et al. (2012) Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53. Dev Biol. 361(2):263-76.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.