Nucleostemin cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Nucleostemin cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1650 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human guanine nucleotide binding protein-like 3 (nucleolar).
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.65kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nucleostemin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nucleostemin cDNA ORF Clone, Human, untagged: Synonyms

C77032 cDNA ORF Clone, Human; E2IG3 cDNA ORF Clone, Human; NNP47 cDNA ORF Clone, Human; NS cDNA ORF Clone, Human

Nucleostemin Background Information

GNL3 (G Protein Nucleolar 3, also known as NS) is a Protein Coding gene. GNL3 belongs to the TRAFAC class YlqF/YawG GTPase family. The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. GNL3 is widely expressed in the urinary bladder, prostate, and other tissues. GNL3 protein has been recently documented to be a nucleolar protein that was abundantly expressed in stem cells and cancer cells. NS may contribute to sorafenib resistance in HCC cells through the modulation of the p53 pathway and Bcl-2 proteins. That the combination of silencing NS expression and sorafenib treatment is a promising therapeutic strategy in the treatment of HCC. GNL3 is a potential genetic modifier for knee osteoarthritis (KOA) development.
Full Name
guanine nucleotide binding protein-like 3 (nucleolar)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.