NFkB1/p105 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

NFkB1/p105 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2907 bp
Description
Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NFkB1/p105 cDNA ORF Clone, Human, C-HA tag: Synonyms

EBP-1 cDNA ORF Clone, Human; KBF1 cDNA ORF Clone, Human; NF-kappa-B cDNA ORF Clone, Human; NF-kappaB cDNA ORF Clone, Human; NF-kB1 cDNA ORF Clone, Human; NFkappaB cDNA ORF Clone, Human; NFKB-p105 cDNA ORF Clone, Human; NFKB-p50 cDNA ORF Clone, Human; p105 cDNA ORF Clone, Human; p50 cDNA ORF Clone, Human

NFkB1/p105 Background Information

NFKB1 (Nuclear Factor Kappa B Subunit 1) is a Protein Coding gene. This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Diseases associated with NFKB1 include Immunodeficiency, Common Variable, 12, and Common Variable Immunodeficiency. Among its related pathways are GDNF-Family Ligands and Receptor Interactions and Apoptosis Modulation and Signaling.
Full Name
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Lougaris V, et al. (2017) Nfkb1 regulates human nk cell maturation and effector functions. Clin Immunol 175 99-108.
  • Eluard B, et al. (2020) Nf-κb in the new era of cancer therapy. Trends Cancer 6 (8): 677-687.
  • Dieli-Crimi R, et al. (2018) Th1-skewed profile and excessive production of proinflammatory cytokines in a nfkb1-deficient patient with cvid and severe gastrointestinal manifestations. Clin Immunol 195 49-58.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.