NFkB1/p105 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

NFkB1/p105 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2946 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+2.95kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

NFkB1/p105 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NFkB1/p105 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

NFkB1/p105 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

EBP-1 cDNA ORF Clone, Human; KBF1 cDNA ORF Clone, Human; NF-kappa-B cDNA ORF Clone, Human; NF-kappaB cDNA ORF Clone, Human; NF-kB1 cDNA ORF Clone, Human; NFkappaB cDNA ORF Clone, Human; NFKB-p105 cDNA ORF Clone, Human; NFKB-p50 cDNA ORF Clone, Human; p105 cDNA ORF Clone, Human; p50 cDNA ORF Clone, Human

NFkB1/p105 Background Information

NFKB1 (Nuclear Factor Kappa B Subunit 1) is a Protein Coding gene. This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Diseases associated with NFKB1 include Immunodeficiency, Common Variable, 12, and Common Variable Immunodeficiency. Among its related pathways are GDNF-Family Ligands and Receptor Interactions and Apoptosis Modulation and Signaling.
Full Name
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Lougaris V, et al. (2017) Nfkb1 regulates human nk cell maturation and effector functions. Clin Immunol 175 99-108.
  • Eluard B, et al. (2020) Nf-κb in the new era of cancer therapy. Trends Cancer 6 (8): 677-687.
  • Dieli-Crimi R, et al. (2018) Th1-skewed profile and excessive production of proinflammatory cytokines in a nfkb1-deficient patient with cvid and severe gastrointestinal manifestations. Clin Immunol 195 49-58.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.