NFkB1/p105 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

NFkB1/p105 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2907 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

NFkB1/p105 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

EBP-1 cDNA ORF Clone, Human; KBF1 cDNA ORF Clone, Human; NF-kappa-B cDNA ORF Clone, Human; NF-kappaB cDNA ORF Clone, Human; NF-kB1 cDNA ORF Clone, Human; NFkappaB cDNA ORF Clone, Human; NFKB-p105 cDNA ORF Clone, Human; NFKB-p50 cDNA ORF Clone, Human; p105 cDNA ORF Clone, Human; p50 cDNA ORF Clone, Human

NFkB1/p105 Background Information

NFKB1 (Nuclear Factor Kappa B Subunit 1) is a Protein Coding gene. This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Diseases associated with NFKB1 include Immunodeficiency, Common Variable, 12, and Common Variable Immunodeficiency. Among its related pathways are GDNF-Family Ligands and Receptor Interactions and Apoptosis Modulation and Signaling.
Full Name
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Lougaris V, et al. (2017) Nfkb1 regulates human nk cell maturation and effector functions. Clin Immunol 175 99-108.
  • Eluard B, et al. (2020) Nf-κb in the new era of cancer therapy. Trends Cancer 6 (8): 677-687.
  • Dieli-Crimi R, et al. (2018) Th1-skewed profile and excessive production of proinflammatory cytokines in a nfkb1-deficient patient with cvid and severe gastrointestinal manifestations. Clin Immunol 195 49-58.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.