NCAM cDNA ORF Clone, Human, N-His tag

1/1
Price:
Size:
Number:

NCAM cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2322 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1656T/G not causing the amino acid variation.
Description
Full length Clone DNA of Human neural cell adhesion molecule 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI(6kb+2.32kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NCAM cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NCAM cDNA ORF Clone, Human, N-His tag: Validated Images

NCAM cDNA ORF Clone, Human, N-His tag: Synonyms

CD56 cDNA ORF Clone, Human; MSK39 cDNA ORF Clone, Human; NCAM cDNA ORF Clone, Human

NCAM Background Information

NCAM1 (Neural Cell Adhesion Molecule 1, also known as CD56) is a Protein Coding gene. 3 alternatively spliced human isoforms have been reported. NCAM1 is a neural adhesion protein (NCAM) that belongs to the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. NCAM1 is involved in neuron-neuron adhesion, neurite fasciculation, the outgrowth of neurites, etc. It has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Diseases associated with NCAM1 include Rabies and Bile Duct Cancer. Among its related pathways are Neuroscience and RET signaling.
Full Name
neural cell adhesion molecule 1
References
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.

NCAM cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.