NCAM cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

NCAM cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2286 bp
Description
Full length Clone DNA of Human neural cell adhesion molecule 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

NCAM cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

CD56 cDNA ORF Clone, Human; MSK39 cDNA ORF Clone, Human; NCAM cDNA ORF Clone, Human

NCAM Background Information

NCAM1 (Neural Cell Adhesion Molecule 1, also known as CD56) is a Protein Coding gene. 3 alternatively spliced human isoforms have been reported. NCAM1 is a neural adhesion protein (NCAM) that belongs to the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. NCAM1 is involved in neuron-neuron adhesion, neurite fasciculation, the outgrowth of neurites, etc. It has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Diseases associated with NCAM1 include Rabies and Bile Duct Cancer. Among its related pathways are Neuroscience and RET signaling.
Full Name
neural cell adhesion molecule 1
References
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.

NCAM cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.