MUC1 cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

MUC1 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mucin 1, cell surface associated, transcript variant 2 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6kb + 1.52kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MUC1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MUC1 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

MUC1 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

ADMCKD cDNA ORF Clone, Human; ADMCKD1 cDNA ORF Clone, Human; CA15-3 cDNA ORF Clone, Human; CD227 cDNA ORF Clone, Human; EMA cDNA ORF Clone, Human; H23AG cDNA ORF Clone, Human; KL-6 cDNA ORF Clone, Human; MAM6 cDNA ORF Clone, Human; MCD cDNA ORF Clone, Human; MCKD cDNA ORF Clone, Human; MCKD1 cDNA ORF Clone, Human; MUC-1 cDNA ORF Clone, Human; MUC-1/SEC cDNA ORF Clone, Human; MUC-1/X cDNA ORF Clone, Human; MUC1/ZD cDNA ORF Clone, Human; Mucin 1 cDNA ORF Clone, Human; PEM cDNA ORF Clone, Human; PEMT cDNA ORF Clone, Human; PUM cDNA ORF Clone, Human

MUC1 Background Information

Mucin 1, cell surface-associated (MUC1) or polymorphic epithelial mucin (PEM) is a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach, and pancreas. MUC-1/CC1/CD227 Exclusively located in the apical domain of the plasma membrane of highly polarized epithelial cells. After endocytosis, internalized, and recycled to the cell membrane. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. The alpha subunit has cell adhesive properties. MUC-1/CC1/CD227 Can act both as an adhesion and an anti-adhesion protein. This protein May provide a protective layer on epithelial cells against bacterial and enzyme attack. The beta subunit contains a C-terminal domain which is involved in cell signaling, through phosphorylations and protein-protein interactions. MUC-1/CC1/CD227 participated in modulates signaling in ERK, SRC, and NF-kappa-B pathways. In the activated T-cells, MUC-1/CC1/CD227 influences directly or indirectly the Ras/MAPK pathway. MUC-1/CC1/CD227 Promotes tumor progression and regulates TP53-mediated transcription and determines cell fate in the genotoxic stress response. Binds, together with KLF4, the PE21 promoter element of TP53 and represses TP53 activity.
Full Name
mucin 1, cell surface associated
Research Areas
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
References
  • Brayman M, et al. (2004) MUC1: a multifunctional cell surface component of reproductive tissue epithelia. Reprod Biol Endocrinol 2: 4.
  • Schroeder J A, et al. (2001) Transgenic MUC1 interacts with epidermal growth factor receptor and correlates with mitogen-activated protein kinase activation in the mouse mammary gland. J Biol Chem. 276 (16): 13057-64.
  • Li Y, et al. (2001) The epidermal growth factor receptor regulates interaction of the human DF3/MUC1 carcinoma antigen with c-Src and beta-catenin. J Biol Chem. 276 (38): 35239-42.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.